Loading...

Summer Research Fellowship Programme of India's Science Academies

Investigating the role of biophysical factors in breast cancer metastasis

Poornima S

B.Tech Student (Biotechnology), Kumaraguru College of Technology, Coimbatore 641049, Tamil Nadu

Dr. Neha Arya

DST Inspire Faculty, Department of Biochemistry, All India Institute of Medical Sciences Bhopal, Saket Nagar, Bhopal 462020, Madhya Pradesh

Abstract

Breast Cancer is the leading cause of cancer related deaths among Indian women population with mortality rates around 12.7 per 100,000 women. Despite considerable progress in breast cancer treatment, prognosis of such patients is limited due to the development of distant metastasis. Distant metastasis by itself accounts for roughly 90% of deaths (Cummings et al. 2014). Therefore, it is crucial to design newer therapeutics that target breast cancer metastasis. About 70% of the advanced stage breast cancer patients report bone metastasis. During metastasis, the breast cancer cells colonize secondary sites; during the course of their movement, they experience dynamic biophysical microenvironment (topography, mechanical strength and biochemical factors). Hence, recapitulating these parameters using an in vitro model will provide a platform to understand the role of these factors in inducing breast cancer metastasis and provide ways to target breast cancer metastasis. In this regard, tissue-engineering approaches have been utilized to generate three-dimensional (3-D) models that demonstrate improved correlation to in vivo environment as compared to cells grown on conventional two-dimensional (2-D) surfaces. In this study, we aim to understand the role of mechanical properties in modulating the behavior of breast cancer cells. Towards this aim, scaffolds with varying mechanical properties will be generated and breast cancer cell adhesion, growth and expression of metastatic genes will be studied.

Keywords: 3-D cell culture, breast cancer metastasis, tumor microenvironment, breast cancer tumor model, biophysical factors

Abbreviations

Abbreviations
2D Two Dimensional
3D Three Dimensional
HR Hormone Receptor
ER Estrogen Receptor
PR Progesterone Receptor
TNBC Triple Negative Breast Cancer
ECM Extra Cellular Matrix
GelMA Methacrylated gelatin Hydrogels
UV Ultra Violet Radiation
MDA-MB-231 M. D. Anderson Metastatic Breast 231
DoF Degree of Functionalization
TNBS Trinitro Benzene Sulfonic
SDS Sodium Dodecyl Sulphate
MAA Methacrylic Anhydride
PBS Phosphate Buffered Saline
MWCO Molecular Weight Cut Off
MTT 1-(4,5-Dimethylthiazol-2-yl)-3,5-diphenylformazan
EMT Epithelial – Mesenchymal Transition

INTRODUCTION

Background and Rationale

Breast cancer is the most common cancer in females worldwide; it represents nearly a quarter (25%) of all cancers with an estimated 1.67 million new cancer cases diagnosed in 2012 (Malvia, Bagadi, Dubey, & Saxena, 2017). Women from less-developed regions (883,000 cases) have demonstrated slightly more number of cases of breast cancer as compared to more-developed (794,000) regions. Despite the advancements in cancer therapeutics, there is a significant increase in the incidence and cancer‐associated morbidity and mortality even in Indian subcontinent, as described in the global and Indian studies (Malvia, Bagadi, Dubey, & Saxena, 2017). 

Breast cancer is a heterogeneous disease with respect to molecular alterations, cellular composition, and clinical outcome. This diversity along with the invasive metastatic behavior of breast cancer creates a challenge in developing tumor classifications that are clinically useful with respect to prognosis or prediction (Parker et al. 2009). Basically, breast cancer has been classified into different subtypes, based on the presence or absence of three receptors found on cancer cells (Fragomeni, Sciallis and Jeruss, 2018). The first type is termed as ‘Hormone receptor (HR) positive breast cancer’ in which estrogen and /or progesterone receptors (ER/PR) are over expressed; approximately 60% of all breast cancers fall into this category. The second type is based on the overexpression of oncogenic human epidermal growth factor receptor 2 (HER-2); HER-2 is overexpressed in approximately 20% of all breast cancers. Remaining 20% cases are negative for the expression of ER, PR and HER-2 and are termed as triple negative breast cancer (TNBC) (Niemeier, Dabbs, Beriwal, Striebel, & Bhargava, 2010). Among the various types of breast cancers, the triple negative breast cancer is characterized by its unique molecular profile, aggressive behavior, distinct patterns of metastasis, and lack of targeted therapies. Targeted agents, including epidermal growth factor receptor (EGFR), vascular endothelial growth factor (VEGF), and poly (ADP-ribose) polymerase (PARP) inhibitors, are currently in clinical trials and hold promise in the treatment of this aggressive disease (Anders and Carey, 2008).

Although breast cancer has long been part of the human condition, appearing in the writings of ancient Egyptians, modern breast cancer shows a disturbing statistical increase from 1 per 20 women in the 1960s to one in eight today. To add to this, distant metastasis accounts for roughly 90% of breast cancer associated deaths (Cummings et al. 2014). In order to combat the high percentage of breast cancer metastasis, understanding the factors involved in breast cancer metastasis is the need of the hour. In general, metastasis is associated with the myriad stages of tumor progression that lead to the dissemination of breast cancer cells from primary tumor and their propagation to distant sites. The first stage in this progression involves ‘loss of local constraints’, both physical and regulatory, emanating from neighboring normal cells and surrounding stroma. The second step termed ‘intravasation’, involves entering a circulatory system (blood and/or lymphatic) and is followed by ‘dissemination’ as well as survival within hostile ectopic environments. The last step usually involves organotropic colonization of compatible sites (Cowin & Welch, 2007). During metastasis, cells undergo epithelial-to-mesenchymal transition (EMT) and lose their epithelial-like characteristics, such as, polarity, cell-cell contact and acquire a more malignant phenotype (Polyak & Weinberg, 2009). Further, EMT is associated with down regulation of epithelial markers like E-cadherin with concomitant up regulation of mesenchymal markers such as N-cadherin and vimentin. EMT is also controlled by a network of transcription factors such as TWIST1, TWIST2, SNAI1, SNAI2 , ZEB1 and ZEB2 (Yang et al. 2004; Batlle et al. 2000; Hajra et al. 2002; Comijn et al. 2001). 

Complexity of aberrations that lead to the epithelial-to-mesenchymal transition in various tumors including breast cancer has been shown to be contributed by both genetic and epigenetic state of the cell (Herceg & Hainaut, 2007; Lustberg & Ramaswamy, 2009). However, in addition to genetic, epigenetic and biochemical factors, metastasis has also been shown to be influenced by the biophysical microenvironment of the tumor (Fang et al. 2014). Few studies have recognized the role of tumor rigidity and extracellular matrix (ECM) topography as key biophysical factors affecting breast cancer metastasis (Paszek et al. 2005; Levental et al. 2009; Conklin et al. 2011; Han et al. 2016). More specifically, enhanced tumor rigidity is strongly correlated to breast cancer metastasis and poor patient outcome (Provenzano et al. 2006). Therefore, understanding the mechanisms by which these dynamic biophysical factors regulate breast cancer metastasis would result in novel therapeutics and can also be used as potential screening platforms. 

Most of our knowledge of  cancer progression is obtained from cancer models generated on 2- dimensional (2D) surfaces or in vivo models. Although 2-D models involve simple and convenient culturing practices, they lack the right microenvironmental conditions for the growth of tumor cells. On the other hand, one of the main challenges in developing in vivo models have been the increasing understanding of the many different subtypes of breast cancer and in vivo animal models do not share the exact histological features of human tumors. Other limitations of in vivo models include the necessity for animal facilities, increased incubation periods and ethical constraints. Therefore, in the recent years, there is a shift towards 3-D in vitro models, which offer the possibility to maintain cells in completely controlled environmental conditions, allowing the study of specific cellular and molecular pathways in shorter experimental timescales and at the same time being less expensive and less time-consuming than animal models (Holen et al. 2017). This study reported the role of matrix stiffness (as a function of different degree of functionalization of the biopolymer) on the proliferative and metastatic potential of MDA-MB-231 breast cancer cells.

3D Tumor Modelling Using Methacrylated Gelatin

Over recent years, tissue engineering has been utilized towards the generation of  three dimensional (3D) disease models for better understanding of tumor pathophysiology and as drug screening platforms. Disease modeling using tissue engineering utilizes 3-D scaffolds as synthetic structures that imitate the physiology of the in vivo microenvironment. In this regard, various natural and synthetic polymers have been utilized for the generation of in vitro tumor models (Yamada and Cukierman, 2007). Additionally, few studies have also reported the role of biophysical factors, namely stiffness in regulating breast cancer metastasis (Baker et al. 2010). The study utilized synthetic polymers such as polyacrylamide, poly (lactic-co-glycolic) acid (PLGA) and polycaprolactone (PCL). In one such study, the authors reported that the cancer cell-laden polymeric scaffolds support consistent tumor formation in animals and biomarker expression as seen in human native tumors as well as that the porous synthetic polymeric scaffolds satisfy the basic requirements for 3D tissue cultures, both in vitro and in vivo (Rijal, Bathula and Li, 2017).

During metastasis, breast cancer cells secrete matrix metalloproteinases in order to cleave the basement membrane and reach secondary sites (Rodríguez, Morrison and Overall, 2010). In this regard, the matrix metalloproteinases contain three fibronectin type II-like modules, which form their collagen binding domains and these domains also play a central role during MMP cleavage in gelatin (Xu et al., 2004). Therefore, natural polymers such as gelatin have been explored for the generation of in vitro tumor models (Liu et al., 2018).

Gelatin is distinguished by its excellent biocompatibility, degradability, and low costs. Due to these features, gelatin has been extensively described for 3-D cell culture applications (Pepelanova, Kruppa, Scheper, & Lavrentieva, 2018). In addition to this, gelatin can easily be functionalized with methacrylic anhydride, which can then be crosslinked using UV light in the presence of a photoinitiator (Choi et al. 2019) . Moreover, the role of gelatin with varying degree of methacrylic anhydride (which can be corelated to stiffness) in modulating the behavior of breast cancer cells, MDA-MB-231 have not been explored yet. Therefore, in this study, we demonstrate the fabrication gelatin with varying degree of functionalization of methacrylic anhydride. Following the characterization of methacrylated gelatin, GelMA hydrogels were fabricated and a breast cancer cell line, MDA-MB-231 was seeded on GelMA hydrogels. The MDA- MB-231 cell line is considered as one of the best models exhibiting the invasive phenotype and the heterogeneity of breast cancer. Cell seeded hydrogels were then tested for their viability, change in cellular morphology and gene expression of stemness markers and epithelial-to-mesenchymal (EMT) markers as a function of degree of methacrylation of gelatin hydrogels.

Objectives of the Research

1) Fabrication and characterization of varying degrees of methacrylated gelatin.

2) Synthesis of GelMA hydrogels.

3) Investigating the morphology and viability of MDA-MB-231 seeded on GelMA with varying degree of methacrylation.

4) Understanding the role of different degree of methacrylation on EMT markers of breast cancer cells seeded on the hydrogels. 

LITERATURE REVIEW

Breast cancer is the most common cancer in women, and approximately 90% of breast cancer deaths are caused by local invasion and distant metastasis of tumor cells. EMT is a vital process for large-scale cell movement during morphogenesis at the time of embryonic development. Tumor cells usurp this developmental program to execute the multi-step process of tumorigenesis and metastasis (Yifan Wang & Zhou, 2011). According to an eminent MIT cancer researcher, Sir Robert Weinberg, 'EMT is a normal process in embryonic development in which epithelial cells transform into mesenchymal cells, the highly mobile cells that give rise to bone, muscle, connective tissue, and blood vessels'.

Evolution of the Concept- Epithelial Mesenchymal Transition

During the early period of 1980’s,the first cancer link got into existence in which by the researcher from “The Centre National de la Recherché Scientifique” in France reported that rat bladder carcinoma cells in culture could transform into invasive mesenchymal tumor cells and back. Later, from the period of 1990’s the paradigm of EMT was the prioritized research theme for the cancer cell biologists. In 2002, the researchers  from “The Cajal Institute in Madrid” showed that expression of Snail, a transcription factor crucial for EMT in embryonic development, correlated closely with invasiveness in primary human tumor samples. Two years later, it was reported that Twist, another transcription factor important in development, is highly expressed in tumor cell lines and invasive human tumors and promotes EMT as well. To add to this, Neilson showed that tumor cells exhibiting fibroblast-specific protein 1 (FSP1) showed increased metastatic properties compared to the tumor cells which were isolated from non–FSP1-injected mice (Deng et al., 2009). It was the first study to demonstrate EMT in cancer under in vivo conditions (Garber, 2008). Later, Sarkar et al. gave two hypothesis which explained the crosstalk between EMT and metastasis (Sarkar et al. 2013). In the first hypothesis, cancer progenitor cells present in a tumor do not undergo EMT simultaneously, so the tumor population contains cells at different stages of differentiation. The second hypothesis suggests that some cancer progenitor cells initially undergo EMT and then metastasize following clonal expansion (Heerboth et al. 2015).

Until recently, breast cancer studies focused on signaling that occurred within epithelial cells and the EMT mechanisms but did not account for the complex molecular circuits regulated by the breast microenvironment. In particular, collagen, an ECM macromolecule was thought to be an inert barrier to tumor invasion and metastasis. Studies over the past seven years, however, provide evidence that collagen has a dynamic role in breast microenvironment and is an active participant that promotes tumor progression.(Lu, Weaver, & Werb, 2012). Evidence is increasing on the crucial role of the ECM in breast cancer progression, invasion and metastasis (Jena & Janjanam, 2018).

A Glance on ECM

The ECM is the non-cellular component present within all tissues and organs, which not only provides the essential physical scaffolding for the cellular constituents but also initiates crucial biochemical and biomechanical cues that are required for tissue morphogenesis, differentiation and homeostasis (Frantz, Stewart, & Weaver, 2010). The structures and compositions of the matrices differ in different tissues, in regions of the same tissue, and at different times in development. ECM can have many functions such as strengthening tissues under physical stress, acting as barriers that inhibit cell migration or substrates upon which cells migrate, serving as molecular filters, and providing signals that alter cell differentiation (Kramer & M., 1997). A critical component of the mechanotransduction process is the ECM and its interface with resident cells. In this regard, the ECM interacts with cells to provide relevant micro environmental information, biochemically through soluble and insoluble mediators and physically through imposition of structural and mechanical constraints (Pizzo, 2005). Thus, the composition and three-dimensional ultra structure of the ECM is highly related to cell phenotype and the required functions of the tissue or organ from which it is derived (Brown et al., 2010).

During invasion of cancer cells into the ECM is a key step in tumor infiltration and metastasis (Pathak & Kumar, 2011) and ECM has a dynamic role in microenvironment of the breast tissue and promotes tumor progression (Seewaldt, 2014). The ECM influences in altering the composition and organization on a large scale when compared to the mammary gland under homeostasis. The matrix proteins that are being induced in breast cancer includes fibrillar collagen, fibronectin, specific laminins and proteoglycans as well as matricellular proteins. Growing proofs suggests that many of these induced ECM proteins play a major functional role in breast cancer progression and metastasis. The induced ECM proteins have been shown to be essential components of metastatic niches, promoting stem/progenitor signaling pathways and metastatic outgrowth (Insua-Rodríguez and Oskarsson, 2016). 

Impact of ECM Stiffness in Tumor

Recent studies have highlighted the role of the ECM and shown the importance of deregulated ECM dynamics in molecular etiology of cancer development (Lu, Takai, Weaver, & Werb, 2011). Cell-cell and cell-matrix interactions play a major role in tumor growth and invasion (Droz, Patey, Paraf, Chrétien, & Gogusev, 1994). ECM stiffness is an isometric force that exerts its effects gradually and chronically on cell behavior, predominantly at the nanoscale level. An increase in ECM protein concentration, increased matrix crosslinking or parallel reorientation of matrix fibrils within a stromal matrix can stiffen a tissue locally to alter cell growth or direct cell migration, albeit to differing degrees (Butcher, Alliston, & Weaver, 2009). The alterations in tumor cell structure and mechanics during detachment and invasion are accompanied by reciprocal changes in ECM topology (organization) and materials properties (mechanics). The tumor formation in vivo is accompanied by a progressive stiffening of the tissue and ECM, as evidenced by the finding that mammary tumor tissue and tumor-adjacent stroma are between 5–20 times stiffer than normal mammary gland (Paszek et al. 2005). The extracellular matrix serves not only as the scaffold upon which tissues are organized but also provides critical biochemical and biomechanical cues that direct cell growth, survival, migration and differentiation and modulate vascular development and immune function. Thus, while genetic modifications in tumor cells undoubtedly initiate and drive malignancy, cancer progresses within a dynamically evolving ECM that modulates virtually every behavioral facet of the tumor cells (Pickup et al. 2014). Most of the previous studies were on validating the efficacy of GelMA hydrogels and examining if it is a suitable platform to model specific attributes of breast cancer. However, to the best of our knowledge, none of the studies have demonstrated the effect of varying degree of gelatin methacrylation on metastatic property of breast cancer cells. Therefore, in this study, we understand the role of gelatin methacrylation in affecting the metastatic property of MDA-MB-231 breast cancer cells. We focus on how the stiffness (as a function of different degree of gelatin methacrylation) regulates the cellular and metastatic behavior of MDA-MB-231.

  

MATERIALS AND METHODS

Fabrication of Methacrylated Gelatin Solution (GelMA)

The methacrylated gelatin was prepared by the reaction of  gelatin (porcine skin, type A, sigma) and methacrylic anhydride according to (Loessner et al. 2016) (Figure 1). Briefly, 10% gelatin (w/v) was dissolved in 1X PBS at 50°C and after complete dissolution of the polymer, different concentrations (5% and 25% (w/v) of methacrylic anhydride were added to the gelatin solution, dropwise in two separate experiments. The solutions were stirred vigorously at 60°C for 1 hour until homogeneously opaque solutions were obtained. gelatin solutions were then subjected to centrifugation at 3,500g for 3 minutes at room temperature in order to remove the unbound methacrylic acid, following which the solution was diluted with twice the volume of prewarmed 1X PBS. Diluted solution was then dialysed against ultra pure water at 40–50°C for 7 days (Brodsky & Andrews, 2011). Following dialysis, the samples of varying concentrations of GelMA were frozen at −80°C and then lyophilized for 3 days. The degree of methacrylation was confirmed by 1H NMR and Trinitro-benzene Sulfonic (TNBS) assay.

Determination of Degree of Functionalization

Trinitro benzene sulphonic (TNBS) acid assay

The degree of functionalization (DoF) was determined by the Trinitro Benzene Sulfonic (TNBS) acid method (Habeeb, 1966). Briefly, lyophilized methacrylated gelatin samples and non- functionalized gelatin, type A was dissolved in 0.1 M sodium carbonate buffer (1.6 mg/mL, pH 8.5). Following this, equal volumes of working reagent (0.01% TNBS solution in 0.1M sodium carbonate buffer) and the samples (200 µl each) were mixed and incubated for 2 h at 37°C. The reaction was stopped by the addition of 80 µL of 1M HCl and 200 µL 0f 10% SDS to the reaction volume. The resulting absorbance was measured at 335 nm with a spectrophotometer (Microplate reader, Biotek). Degree of functionalization was calculated by preparing a standard curve of glycine.  

1H nuclear magnetic resonance spectroscopy

1H NMR was used to determine the methacrylation degree in gelatin methacrylated samples (GelMA) (Yihu Wang et al. 2018). Briefly 10 mg of gelatin and gelatin methacrylated samples were dissolved in 0.4 mL of Deuterium oxide (D2O, Sigma) to get clear solution. The spectrum was obtained from Bruker’s AVANCE-III 500MHz FT NMR spectrometer at 37°C. Baseline correction was applied before obtaining the area under the desired peaks.

Synthesis of Hydrogels by Photocrosslinking

Lyophilised gelatin methacrylated samples(GelMA) (5% and 25% respectively) were weighed accordingly and incubated with 1X PBS and 0.05% (wt/vol) 2-hydroxy-40-(2-hydroxyethoxy)-2-methylpropiophenone (Irgacure 2959, sigma) overnight at 4°C followed by 3 hour incubation in a water bath at 37°C until samples got completely dissolved. Solubilised gelMA-irgacure solution was poured in moulds and subjected to photo cross linking for 20 minutes in the UV Photo cross linker at an intensity of approximately 5.3 to 5.4 mW/cm2 to form hydrogels (figure 1B). Prior to the cell seeding the photo cross linked hydrogels were washed thrice with 1X PBS for 10 minute each and overnight incubated with complete cell culture media (MEM) with 10% FBS, 1% pencillin-streptomycin and 1% amphotericinB. 

Cell Culture

The M. D. Anderson Metastatic Breast 231 (MDA-MB-231) cell line was used for this study. The basal medium used for all cell culture experiments was Modified Eagle’s medium, supplemented with 10% fetal bovine serum (FBS), 1% nonessential amino acids and 1% antibiotics (streptomycin sulphate and benzyl penicillin). Cell culture were maintained at 37°C in atmosphere of 5% CO2 for all experiments. 

Cell Viability

Cell viability was measured using MTT Assay. The in vitro tetrazolium-based colorimetric assay (MTT) is used to  detect mammalian cell survival and proliferation, and is a rapid assay based on the cleavage of a yellow tetrazolium salt (3{4,5-dimethylthiazol-2-yl-2,5-diphenyl tetrazolium bromide) to purple formazan crystals by mitochondrial enzymes of metabolically active cells (Ciapetti, Cenni, Pratelli, & Pizzoferrato, 1993). Briefly 5x103 cells were seeded in 5% and 25% GelMA hydrogels (n=2). The samples were mixed with the MTT solution and incubated in the CO2 incubator for 4 hours and the formazan crystals were dissolved in an organic solvent (dimethyl sulphoxide). The viability of the cells was measured at 570 nm with the reference of 650 nm using the Micro Plate Reader on 2nd, 4th and 6th day of cell seeding respectively.

Morphological Analysis

Cells were plated at a density of approximately 5,000-cells/cm2 (n=2) and allowed for 6 days to reach confluency. Then, cells were fixed with 4% paraformaldehyde for 10 minutes, washed in phosphate buffered saline (PBS), permeabilized with 0.1% Triton X-100 for 10 minutes and then blocked with 1% BSA (bovine serum albumin) for 30 minutes. Samples were then rinsed with washing buffer (PBS with Tween 20) and incubated with Alexa 488-phalloidin and DAPI to stain for F-actin and nuclei respectively. Phase-contrast and fluorescence micrographs were collected using a CCD camera mounted on a Nikon TE-2000 inverted microscope with 20× objective lens. The nuclear aspect ratio of MDA-MB-231 was calculated by measuring the length and breadth of the nucleus using Image J software.

Gene Expression Studies

Briefly, 4x104 cells were seeded onto the 5% and 25% GelMA hydrogels in a 48 well plate for the gene expression studies. After 7 days, RNA was isolated from cells using TRIZOL – chloroform method (Arya et al. 2016). cDNA was synthesized using iscript cDNA kit (Biorad) and quantitative real-time PCR (qRT-PCR) was carried out using SYBR Green chemistry for different EMT markers like OCT 4, Nanog, CXCR 4, and Twist. Gene expression was normalized to 18S rRNA, and the fold change was calculated using the 2−ΔΔCt method.

Sequence of Primers used in Real time PCR
Oct 4   FWD ACCCACACTGCAGCAGATCA
REV CTCGTTGTGCATAGTCGCTGA
     
NANOG   FWD CTCCATGAACATGCAACCTG
REV GAGGAAGGATTCAGCCAGTG
     
TWIST   FWD CCACTGAAAGGAAAGGCATC
REV CTATGGTTTTGCAGGCCAGT
     
CXCR4   FWD GCGAAGAAAGCCAGGATGAGGAT
REV GCGAAGAAAGCCAGGATGAGGAT
     
18s rRNA   FWD GGTAACCCGTTGAACCCCAT
REV CAACGCAAGCTTATGACCCG

RESULTS AND DISCUSSION

Degree of Functionalization

As a first step of this work, GelMA of varying concentrations of methacrylic anhydride were synthesized using the previously described method (Aldana et al. 2019). Gelatin was mixed at 10% (w/v) in Dulbecco’s phosphate-buffered saline (DPBS) at 50 degree celsius and stirred until completely dissolved. Varying degree of methacrylation was achieved by adding 5% and 25% (w/v) of MA to the synthesis reaction. MA was added dropwise under stirred conditions at 50 degrees Celsius and allowed to react for 2 h. After this, the reaction mix was diluted 5 times with D-PBS to stop the reaction and the mixture was dialyzed against distilled water using 12–14 kDa cutoff dialysis tubing for 1 week at 40 degree celsius to remove salts and methacrylic acid. The solution was lyophilized for 1 week to generate a white porous foam and was stored at −80 degrees Celsius. In order to determine methacrylation and degree of methacrylation, the samples were then characterized using 1H NMR and TNBS assay respectively. Methacrylation was confirmed by 1H NMR, that demonstrated the presence of methyl vinyl group at 5.5 ppm peak in functionalized gelatin as compared to non- functionalized gelatin, indicating successful functionalization of gelatin with methacrylic anhydride (Fig 1). Further, in order to quantify the degree of methacrylation, the Habeeb assay was used. The assay determined the extent of substitution of free amine groups in gelatin samples, as the methacrylate groups bound to free amine groups only. The free amino groups in methacrylated gelatin was compared to non-functionalized gelatin and it was observed that the number of free amino groups were higher in non-functionalized gelatin as compared to methacrylated gelatin. Further, gelatin functionalized with 5% methacrylic anhydride possessed higher number of free amino groups as compared to gelatin functionalized with 25% methacrylic anhydride. Taken together, these results demonstrated the successful functionalization of gelatin with 5%and 25% methacrylic anhydride. 

    Figure 1:  1H NMR of gelatin functionalized with 5% and 25% methacrylic anhydride

      Figure 2: Degree of Methacrylation of gelatin functionalized with 5% and 25% methacrylic anhydride as determined by Habeeb method. 

        

      Synthesis of GelMA Hydrogels

      Following the characterization of GelMA, the samples were crosslinked for 20 minutes using the indegenious UV crosslinking chamber (Figure 3). GelMA hydrogels appeared as transparent hydrogels, which were then used for cell culture experiments.

        Figure 3: GelMA-based hydrogel preparation. The critical steps of GelMA-based hydrogel preparation were: (i) Gelatin and methacrylic anhydride were reacted to add methacrylate pendant groups to gelatin. (ii) The methacrylated gelatin (GelMA polymer) was dissolved in PBS at 37°C, mixed with the photoinitiator Irgacure-2959, and (iii) cross-linked in the presence of 365 nm UV light. 

        Seeding and Characterization of  MDA-MB-231 Cells Seeded on Gelma Hydrogels

        In order to prevent breast cancer cells from attaching the surface of well plates, 1% agarose was coated onto the well plates due to cell-repellant properties of agarose. We performed preliminary control experiments where the circular hydrogel constructs were placed onto the well plates with and without agarose coating (data not shown). When placed on well plates without agarose, most of the cells escaped from the hydrogel constructs and migrated beneath the surface of well plate. These results indicated that, without agarose, the cells adhered heavily to the cell culture well plates. Conversely, agarose coating resulted in cell-repelling properties and facilitated the migration of the cells on the hydrogel layer. It was found that cells seeded on 5% gelMA migrated towards each other forming small spheroid like structures while cells seeded on 25% gelMA maintained flat spindle shape morphology (Figure 4 A, B). Further changes in the cellular and nuclear morphologies were seen through DAPI phalloidin staining. Figure 4 C, D depicts the cells seeded on 5% gelma maintained close proximity to each other and were less dispersed compared to cells on 25% gelMA which were evenly spread throughout the hydrogel and displayed elongated spindle shaped phenotype. Therefore, 5% GelMA promoted spheroid-like phenotype as compared to the breast cancer cells seeded on 25% GelMA.

          Figure 4: Bright field micrographs of MDA-MB-231 breast cancer cells when seeded on 5% (A) and 25% (B) GelMA. Florescent micrographs demonstrating DAPI (nucleus, blue)-phalloidin (actin, green) staining of MDA-MB-231 cells when seeded on 5% (C) and 25% (D) GelMA.

          Cell Viability of MDA-MB-231 Cells Seeded on Gelma Hydrogels

          Next, we performed the viability assay to investigate the cell proliferation induced by the Gel MA with different degrees of functionalization. The reduction of tetrazolium salts is now widely accepted as a reliable way to examine cell proliferation. The yellow tetrazolium MTT (3-(4, 5-dimethylthiazolyl-2)-2, 5-diphenyltetrazolium bromide) is reduced by metabolically active cells, in part by the action of dehydrogenase enzymes, to generate reducing equivalents such as NADH and NADPH. The resulting intracellular purple formazan crystals can then be solubilized and quantified by spectrophotometry. Figure 5 represents the viability of MDA-MB-231 seeded on 5% and 25% GelMA hydrogel constructs as a function of time. It was observed that both the hydrogels demonstrated an increase in absorbance as a function of time indicating their biocompatibility. Further, cells seeded on 5% GelMA hydrogels demonstrated higher viability at the end of day 6 as compared to those seeded on 25% GelMA hydrogels. The results indicated that GelMA substrates functionalized with different concentrations of methacrylic anhydride (as a result stiffness) modulate and support the growth of MDA-MB-231 cells and may provide an insight into the relationship between the stiffness of GelMA substrates and the outgrowth characteristics and morphology of MDA-MB-231cells (Wu et al., 2019).

             To add to this, nuclear aspect ratio (Figure 6) of the breast cancer cells, when seeded on GelMA hydrogels with varying degree of methacrylation  revealed that cells on 5% GelMA maintained the ratio close to 1 suggesting attainment of circular morphology while on 25% gelMA maintained more elongated nuclei.

              Figure 6 : Nuclear aspect ratio of MDA-MB-231 seeded on 5% gelMA and 25% gelMA (p<0.05).

              Gene Expression Studies

              Cancer cell biology is a multifactorial event involving cell growth, migration, invasion and progression. During all these cellular events, certain cancer cells uptake stem cell-like characteristics which have been shown to affect the dynamic structural and molecular propensity of cancer cells to more quiescent form as an adaptation for survival.  Several studies have proved that formation of tumor derived spheroids is often associated with stem cell-like characteristics (Ishiguro et al., 2017). Up regulation of transcription factors such as OCT 4 and Nanog are known to introduce lineage plasticity in cancer cells thereby promoting self renewal, proliferation, motility and evade apoptosis in cancer cells. Further, these factors are also responsible in making cells dormant to the drug therapies and contribute to poor pathological differentiation in breast cancer patients (Yang, Zhang and Yang, 2018). Additionally, EMT activation in breast cancer cells by transcription markers such as TWIST is found to be correlated with the acquisition of stem cell-like properties and is proven to be critical in regulating the expression of stemness markers and sphere forming capacity (Battula et al., 2010). To add to this, the expression of chemokine receptors, CXCR4, has been shown to be correlated to the metastatic properties of breast cancer cells(Schimanski et al., 2005).

              Thus, we studied the expression of stemness markers (OCT4 and NANOG), EMT marker (Twist) and CXCR4 by MDA-MB-231 seeded on 5% and 25% gelMA and found that these factors were up-regulated in MDA-MB-231 cells seeded on 5% GelMA as compared to 25% GelMA. The results indicated that 5% GelMA maintained the stemness characteristics and metastatic property of MDA-MB-231 cells as compared to 25% GelMA. However, further studies are underway to eludicate the associated mechanisms.

                 Figure 7 : Fold change in the expression of stemness markers (OCT 4, Nanog), EMT marker (TWIST) and CXCR4 in MDA-MB-231 seeded on 5% gelMA hydrogels with respect to cells on 25% gelMA hydrogels.

                CONCLUSION

                In this work, photocrosslinkable hydrogels based on gelatin methacrylate were generated and investigated for their ability to maintain the metastatic potential of breast cancer cells, MDA-MB-231. More specifically, gelatin with varying degrees of methacrylation was successfully fabricated and characterized for degree of methacrylation. Further, gelatin hydrogels based on 5% and 25% methacrylation were generated using UV crosslinking (different degrees of methacrylation commensurates different mechanical properties) and were utilized for culturing breast cancer cells, MDA-MB-231. The cells cultured on GelMA hydrogels were then characterized for their morphology, proliferation and expression of stemness and EMT markers. It was observed that while both hydrogels supported the attachment and proliferation of breast cancer cells, gelatin with 5% methacrylation supported spheroid formation as compared to the cells grown on gelatin with 25% methacrylation. 5% GelMA also led to increased expression of stemness markers (oct 4 and sox2), EMT marker (twist) and CXCR4 receptor as compared to the same cells grown on 25% GelMa. The model thus generated demonstrated potential to support the metastatic behavior of breast cancer cells and can be further applied for drug screening/testing applications. 

                ACKNOWLEDGEMENTS

                PS would like to acknowledge Indian Academy of Sciences (IASc-INSA) for financial support. NA would like to acknowledge DST INSPIRE Faculty fellowship for research funding and faculty fellowship. NA and PS would like to acknowledge All India Institute of Medical Sciences Bhopal for infrastructure and mentorship. 

                REFERENCES

                Aldana, A. et al. (2019) ‘Fabrication of Gelatin Methacrylate (GelMA) Scaffolds with Nano- and Micro-Topographical and Morphological Features’, Nanomaterials, 9(1), p. 120. doi:10.3390/nano9010120.

                Anders, C. and Carey, L. A. (2008) ‘Understanding and treating triple-negative breast cancer’, ONCOLOGY, 22(11), pp. 1233–1239.

                Arya, A. D., Hallur, P. M., Karkisaval, A. G., Gudipati, A., Rajendiran, S., Dhavale,V., … Chaubey, A. (2016). Gelatin Methacrylate Hydrogels as Biomimetic Three-Dimensional Matrixes for Modeling Breast Cancer Invasion and Chemoresponse in Vitro. ACS Applied Materials and Interfaces, 8(34), 22005–22017. https://doi.org/10.1021/acsami.6b06309

                Baker, E. L. et al. (2010) ‘Cancer cell stiffness:Integrated roles of three-dimensional matrix stiffness and transforming potential’, Biophysical Journal. Biophysical Society, 99(7), pp. 2048–2057. doi: 10.1016/j.bpj.2010.07.051

                Battula, V. L. et al. (2010) ‘Epithelial-mesenchymal transition-derived cells exhibit multilineage differentiation potential similar to mesenchymal stem cells.’, Stem cells (Dayton, Ohio),28(8), pp. 1435–45. doi: 10.1002/stem.467.

                Brodsky, J. L., & Andrews, D. W. (2011). Ac ce pte d M uscri pt Ac ce pte d M us pt.

                Brown, B. N., Barnes, C. A., Kasick, R. T., Michel, R., Gilbert, T. W., Beer-Stolz, D., … Badylak, S. F. (2010). Surface characterization of extracellular matrix scaffolds. Biomaterials. https://doi.org/10.1016/j.biomaterials.2009.09.061

                Butcher, D. T., Alliston, T., & Weaver, V. M. (2009). A tense situation: Forcing tumour progression. Nature Reviews Cancer. https://doi.org/10.1038/nrc2544

                Chen, B., Co, C., & Ho, C. C. (2015). Cell shape dependent regulation of nuclear morphology. Biomaterials. https://doi.org/10.1016/j.biomaterials.2015.07.017

                Choi, J. R. et al. (2019) ‘Recent advances in photo-crosslinkable hydrogels for biomedical applications’, BioTechniques. Future Science, pp. 40–53. doi: 10.2144/btn-2018-0083.

                Ciapetti, G., Cenni, E., Pratelli, L., & Pizzoferrato, A. (1993). In vitro evaluation of cell/biomaterial interaction by MTT assay. Biomaterials. https://doi.org/10.1016/0142-9612(93)90055-7

                Costa-Almeida, R. et al. (2018) ‘Crosstalk between adipose stem cells and tendon cells reveals a temporal regulation of tenogenesis by matrix deposition and remodeling’, Journal of Cellular Physiology. Wiley-Liss Inc., 233(7), pp. 5383–5395. doi: 10.1002/jcp.26363.

                Cowin, P., & Welch, D. R. (2007). Breast cancer progression: Controversies and consensus in the molecular mechanisms of metastasis and EMT. Journal of Mammary Gland Biology and Neoplasia. https://doi.org/10.1007/s10911-007-9041-9

                Deng, S. et al. (2009) ‘Blocks Tumor Growth via Angiostasis γ IFN-Responsiveness of Stromal Fibroblasts to’. doi: 10.4049/jimmunol.0901073.

                Droz, D., Patey, N., Paraf, F., Chrétien, Y., & Gogusev, J. (1994). Composition of extracellular matrix and distribution of cell adhesion molecules in renal cell tumors. Laboratory Investigation; a Journal of Technical Methods and Pathology, 71(5), 710–718. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/7526040

                Fragomeni, S. M., Sciallis, A. and Jeruss, J. S. (2018) ‘Molecular Subtypes and Local-Regional Control of Breast Cancer’, Surgical Oncology Clinics of North America. W.B. Saunders, pp. 95–120. doi: 10.1016/j.soc.2017.08.005.

                Frantz, C., Stewart, K. M., & Weaver, V. M. (2010). The extracellular matrix at a glance. Journal of Cell Science. https://doi.org/10.1242/jcs.023820

                Garber, K. (2008). Epithelial-to-mesenchymal transition is important to metastasis, but questions remain. Journal of the National Cancer Institute. https://doi.org/10.1093/jnci/djn032

                Gill, B. J., & West, J. L. (2014). Modeling the tumor extracellular matrix: Tissue engineering tools repurposed towards new frontiers in cancer biology. Journal of Biomechanics. https://doi.org/10.1016/j.jbiomech.2013.09.029

                Gkretsi, V. and Stylianopoulos, T. (2018) ‘Cell adhesion and matrix stiffness: Coordinating cancer cell invasion and metastasis’, Frontiers in Oncology. Frontiers Media S.A. doi: 10.3389/fonc.2018.00145.

                Habeeb, A. F. S. A. (1966). Determination of free amino groups in proteins by trinitrobenzenesulfonic acid. Analytical Biochemistry. https://doi.org/10.1016/0003-2697(66)90275-2

                Heerboth, S., Housman, G., Leary, M., Longacre, M., Byler, S., Lapinska, K., … Sarkar, S. (2015). EMT and tumor metastasis. Clinical and Translational Medicine. https://doi.org/10.1186/s40169-015-0048-3

                Holen, I. et al. (2017) ‘In vivo models in breast cancer research: Progress, challenges and future directions’, DMM Disease Models and Mechanisms. Company of Biologists Ltd, pp. 359–371. doi: 10.1242/dmm.028274.

                Insua-Rodríguez, J. and Oskarsson, T. (2016) ‘The extracellular matrix in breast cancer’, Advanced Drug Delivery Reviews. Elsevier B.V., pp. 41–55. doi: 10.1016/j.addr.2015.12.017.

                Ishiguro, T. et al. (2017) ‘Tumor-derived spheroids: Relevance to cancer stem cells and clinical applications’, Cancer Science. Blackwell Publishing Ltd, pp. 283–289. doi: 10.1111/cas.13155.

                Jena, M. K., & Janjanam, J. (2018). Role of extracellular matrix in breast cancer development: a brief update. F1000Research. https://doi.org/10.12688/f1000research.14133.2

                Kramer, & M., J. (1997). 17 Extracellular Matrix. Cold Spring Harbor Monograph Archive, 33(0), 471–500. https://doi.org/10.1101/087969532.33.471

                Kumar, S., & Weaver, V. M. (2009). Mechanics, malignancy, and metastasis: The force journey of a tumor cell. Cancer and Metastasis Reviews. https://doi.org/10.1007/s10555-008-9173-4

                Liu, F. et al. (2018) ‘Natural polymers for organ 3D bioprinting’, Polymers. MDPI AG. doi: 10.3390/polym10111278.

                Loessner, D., Meinert, C., Kaemmerer, E., Martine, L. C., Yue, K., Levett, P. A., … Hutmacher, D. W. (2016). Functionalization, preparation and use of cell-laden gelatin methacryloyl-based hydrogels as modular tissue culture platforms. Nature Protocols, 11(4), 727–746. https://doi.org/10.1038/nprot.2016.037

                Lu, P., Takai, K., Weaver, V. M., & Werb, Z. (2011). Extracellular matrix degradation and remodeling in development and disease. Cold Spring Harbor Perspectives in Biology, 3(12). https://doi.org/10.1101/cshperspect.a005058

                Lu, P., Weaver, V. M., & Werb, Z. (2012). The extracellular matrix: A dynamic niche in cancer progression. Journal of Cell Biology. https://doi.org/10.1083/jcb.201102147

                Malvia, S., Bagadi, S. A., Dubey, U. S., & Saxena, S. (2017, August 1). Epidemiology of breast cancer in Indian women. Asia-Pacific Journal of Clinical Oncology, Vol. 13, pp. 289–295. https://doi.org/10.1111/ajco.12661

                Niemeier, L. A., Dabbs, D. J., Beriwal, S., Striebel, J. M., & Bhargava, R. (2010). Androgen receptor in breast cancer: Expression in estrogen receptor-positive tumors and in estrogen receptor-negative tumors with apocrine differentiation. Modern Pathology, 23(2), 205–212. https://doi.org/10.1038/modpathol.2009.159

                Parikh,D., Stack, M., & Wang, H. (2018). Matrix Stiffness Regulates the Fate of Breast Cancer Cells. Biophysical Journal.https://doi.org/10.1016/j.bpj.2017.11.3519

                Parker, J. S., Mullins, M., Cheang, M. C. U., Leung, S., Voduc, D., Vickery, T., … Bernard, P. S. (2009). Supervised Risk Predictor of Breast Cancer Based on Intrinsic Subtypes. Journal of Clinical Oncology. https://doi.org/10.1200/jco.2008.18.1370

                Paszek,M. J., Zahir, N., Johnson, K. R., Lakins, J. N., Rozenberg, G. I., Gefen, A., …Weaver, V. M. (2005). Tensional homeostasis and the malignant phenotype. Cancer Cell, 8(3), 241–254. https://doi.org/10.1016/j.ccr.2005.08.010

                Pathak, A., & Kumar, S. (2011). Biophysical regulation of tumor cell invasion: Moving beyond matrix stiffness. Integrative Biology. https://doi.org/10.1039/c0ib00095g

                Pepelanova, I., Kruppa, K., Scheper, T., & Lavrentieva, A. (2018). Gelatin-Methacryloyl (GelMA) Hydrogels with Defined Degree of Functionalization as a Versatile Toolkit for 3D Cell Culture and Extrusion Bioprinting. Bioengineering, 5(3), 55. https://doi.org/10.3390/bioengineering5030055

                Pickup, M. W., Mouw, J. K., & Weaver, V. M. (2014). The extracellular matrix modulates the hallmarks of cancer. 15(12), 1243–1253.

                Pizzo, A. M. (2005). Extracellular matrix (ECM) microstructural composition regulates local cell-ECM biomechanics and fundamental fibroblast behavior: a multidimensional perspective. Journal of Applied Physiology. https://doi.org/10.1152/japplphysiol.01137.2004

                Rijal, G., Bathula, C. and Li, W. (2017) ‘Application of Synthetic Polymeric Scaffolds in Breast Cancer 3D Tissue Cultures and Animal Tumor Models’, International Journal of Biomaterials. Hindawi Limited, 2017. doi: 10.1155/2017/8074890.

                Rodríguez, D., Morrison, C. J. and Overall, C. M. (2010) ‘Matrix metalloproteinases: What do they not do? New substrates and biological roles identified by murine models and proteomics’, Biochimica et Biophysica Acta - Molecular Cell Research, pp. 39–54. doi: 10.1016/j.bbamcr.2009.09.015.

                Saha, N. et al. ‘Polymeric biomaterial based hydrogels for biomedical applications’, file.scirp.org. Available at: http://file.scirp.org/pdf/JBNB20110100011_61579547.pdf 

                Sarkar, S., Horn, G., Moulton, K., Oza, A., Byler, S., Kokolus, S., & Longacre, M. (2013). Cancer development, progression, and therapy: An epigenetic overview. International Journal of Molecular Sciences. https://doi.org/10.3390/ijms141021087

                Schimanski, C. C. et al. (2005) Effect of Chemokine Receptors CXCR4 and CCR7 on the Metastatic Behavior of Human Colorectal Cancer.

                Seewaldt, V. (2014). ECM stiffness paves the way for tumor cells. Nature Medicine, 20(4), 332–333. https://doi.org/10.1038/nm.3523

                Seltzer$, J. L. et al. (1981) Purification and Properties of a Gelatin-specific Neutral Protease from Human Skin*, THE JOURNAL OF BIOLOGICAL CHEMISTRY.

                Seyfried, T. N., & Huysentruyt, L. C. (2013). On the origin of cancer metastasis. Critical Reviews in Oncogenesis, 18(1–2), 43–73. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/23237552

                Wang, D., Lu, P., Zhang, H., Luo, M., Zhang, X., Wei, X., … Liu, C. (2014). Oct-4 and Nanog promote the epithelial-mesenchymal transition of breast cancer stem cells and are associated with poor prognosis in breast cancer patients. Oncotarget, 5(21), 10803–10815. https://doi.org/10.18632/oncotarget.2506

                Wang, Yifan, & Zhou, B. P. (2011). Epithelial-mesenchymal transition in breast cancer progression and metastasis. Chinese Journal of Cancer. https://doi.org/10.5732/cjc.011.10226

                Wang, Yihu, Ma, M., Wang, J., Zhang, W., Lu, W., Gao, Y., … Guo, Y. (2018). Development of a photo-crosslinking, biodegradable GelMA/PEGDA hydrogel for guided bone regeneration materials. Materials. https://doi.org/10.3390/ma11081345

                Wu, Y. et al. (2019) ‘The influence of the stiffness of GelMA substrate on the outgrowth of PC12 cells’, Bioscience Reports. Portland Press Ltd, 39(1). doi: 10.1042/BSR20181748.

                Xu, X. et al. (2004) ‘Contributions of the MMP-2 collagen binding domain to gelatin cleavage: Substrate binding via the collagen binding domain is required for hydrolysis of gelatin but not short peptides’, Matrix Biology, 23(3), pp. 171–181. doi: 10.1016/j.matbio.2004.05.002.

                Yamada, K. M. and Cukierman, E. (2007) ‘Modeling Tissue Morphogenesis and Cancer in 3D’, Cell, pp. 601–610. doi: 10.1016/j.cell.2007.08.006.

                Yang, F., Zhang, J. and Yang, H. (2018) ‘OCT4, SOX2, and NANOG positive expression correlates with poor differentiation, advanced disease stages, and worse overall survival in HER2+ breast cancer patients.’, OncoTargets and therapy, 11, pp. 7873–7881. doi: 10.2147/OTT.S173522.

                More
                Written, reviewed, revised, proofed and published with